| mod ID | m6A_site_720277 | mod Site | chr6:52264192-52264193:- | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TCCAGAGCACTTTGGTCTAGACTAGGCTTTGGGTGGTTCCA |
||||||||||||||||||
| Motif Score | 3.31938095238095 | ||||||||||||||||||||
| RNA Structure Motif |
..(((((.((((((...))))))..))))). |
MFE | -8.90 | ||||||||||||||||||
| Support Dataset Num | 22 | Support sub-Dataset Num | 75 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM4024128, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSM928399, GSM928401, GSM908329, GSM908333, GSM908335, GSM908337, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166141, GSM1166142, GSM1166143, GSM1272358, GSM1272360, GSM1272366, GSM1272368, GSM1594131, GSM1723347, GSM1982263, GSM2203052, GSM2203060, GSM2203063, GSM2203064, GSM2283211, GSM2283212, GSM2283213, GSM2283214, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2332977, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2460362, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754222, GSM2754224, GSM2754226, GSM2754235, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2754246, GSM2754248, GSM2464931, GSM2483505, GSM2564019, GSM2564022 |
||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, A549, U2OS, H1A, H1B, GM12878, LCLs, H1299, Huh7, Jurkat, CD4T, peripheral-blood, GSC-11, iSLK, MSC, TIME, TREX, HEC-1-A, GSCs, NB4, MM6 |
||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,DART-seq | ||||||||||||||||||||
| Transcript ID List | ENST00000596288.6,ENST00000616552.4,ENST00000229854.12 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1