RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_72826

mod Site

chr1:202733730-202733731:-

mod Type

m6A

Sequence

GCCCCTATGATTCAATGTGAACTCTGCAGGGATGCTTTCCA

Motif Score

3.37338095238095

RNA Structure Motif

...(..((..((((.....))))..))..).

MFE

-3.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE107954, GSE120229, GSE29714, GSE46705, GSE55572, GSE71154, GSE85724, GSE87515, GSE93911

Support sub-Dataset List

GSM2739506, GSM2991403, GSM2884195, GSM2884197, GSM3396437, GSM3396438, GSM928401, GSM1135032, GSM1135033, GSM1339407, GSM1339439, GSM1828596, GSM2283215, GSM2332975, GSM2464905, GSM2464911, GSM2464913, GSM2464915, GSM2464919

Cell/Tissue List

HeLa, CD34, HEK293T, fibroblasts, A549, CD4T, GSC-11, endometrial

Seq Type List

m6A-seq,MeRIP-seq,m6A-CLIP/IP

Transcript ID List

ENST00000648473.1,ENST00000647657.1,ENST00000650417.1,ENST00000647757.1,ENST00000235790.9,ENST00000649770.1,ENST00000650506.1,ENST00000650569.1,ENST00000472822.6,ENST00000498276.2,ENST00000649542.1,ENST00000367265.8,ENST00000649089.1,ENST00000648338.1,ENST00000648469.1,ENST00000648056.1,ENST00000649230.1,ENST00000649400.1,ENST00000367264.7

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000648473.1	ENSG00000117139.17	KDM5B	protein_coding	cds-23
ENST00000647657.1	ENSG00000117139.17	KDM5B	retained_intron	exon-1
ENST00000650417.1	ENSG00000117139.17	KDM5B	nonsense_mediated_decay	utr3-23
ENST00000647757.1	ENSG00000117139.17	KDM5B	processed_transcript	exon-23
ENST00000235790.9	ENSG00000117139.17	KDM5B	protein_coding	cds-23
ENST00000649770.1	ENSG00000117139.17	KDM5B	protein_coding	cds-22
ENST00000650506.1	ENSG00000117139.17	KDM5B	retained_intron	exon-7
ENST00000650569.1	ENSG00000117139.17	KDM5B	protein_coding	cds-22
ENST00000472822.6	ENSG00000117139.17	KDM5B	retained_intron	exon-1
ENST00000498276.2	ENSG00000117139.17	KDM5B	retained_intron	exon-9
ENST00000649542.1	ENSG00000117139.17	KDM5B	processed_transcript	exon-23
ENST00000367265.8	ENSG00000117139.17	KDM5B	protein_coding	cds-23
ENST00000649089.1	ENSG00000117139.17	KDM5B	nonsense_mediated_decay	utr3-11
ENST00000648338.1	ENSG00000117139.17	KDM5B	protein_coding	cds-23
ENST00000648469.1	ENSG00000117139.17	KDM5B	protein_coding	cds-22
ENST00000648056.1	ENSG00000117139.17	KDM5B	protein_coding	cds-23
ENST00000649230.1	ENSG00000117139.17	KDM5B	retained_intron	exon-9
ENST00000649400.1	ENSG00000117139.17	KDM5B	retained_intron	exon-8
ENST00000367264.7	ENSG00000117139.17	KDM5B	protein_coding	cds-24

Conserved Sites

mm10:m6A_site_26733

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 30065315, 22608085, 24284625, 24981863, 26404942, 27371828, 28344040, 30154548

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.