| mod ID | m6A_site_730395 | mod Site | chr6:110815186-110815187:- | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CGGGGGGAGGAGGAGGAGGGACTGAGCGGCGGCGGCCCCCG |
||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
....................((....))... |
MFE | -1.60 | ||||||||||||||||||||||||||||
| Support Dataset Num | 19 | Support sub-Dataset Num | 52 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884197, GSM2884199, GSM2987449, GSM3582046, GSM3582047, GSM3582054, GSM928399, GSM928403, GSM1166139, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1594131, GSM1723347, GSM1723349, GSM1723351, GSM1908206, GSM1908208, GSM1908210, GSM1908212, GSM1982263, GSM2010454, GSM2010456, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2332978, GSM2332987, GSM2332988, GSM2417477, GSM2417478, GSM2417479, GSM2460350, GSM2460354, GSM2460360, GSM2754211, GSM2754214, GSM2754226, GSM2754248, GSM2464931 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, A549, HEK293T, U2OS, H1A, H1B, hNPCs, hESCs, GM12878, LCLs, MT4, H1299, MM6, Jurkat, GSC-11, HEK293A-TOA, iSLK, MSC, TREX, TIME, HEC-1-A |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000368911.8,ENST00000497709.1,ENST00000460913.1,ENST00000323817.7,ENST00000413605.6 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_50485;panTro5:m6A_site_57874;rheMac8:m6A_site_44885;susScr11:m6A_site_2836 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1