RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_731013

mod Site

chr6:111759010-111759011:-

mod Type

m6A

Sequence

CGCATGGGCCTGGCCGGTGGACAAGATGTGGGAACTGCATG

Motif Score

3.64304761904762

RNA Structure Motif

.(((...)))(((...((.....))...)))

MFE

-3.00

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE125803, GSE85724

Support sub-Dataset List

GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM2283214

Cell/Tissue List

HeLa, CD4T

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000520518.5,ENST00000518295.5,ENST00000523322.5,ENST00000229471.8,ENST00000368678.8,ENST00000484067.6,ENST00000354650.7,ENST00000523238.5,ENST00000368682.7,ENST00000523574.5,ENST00000462598.7,ENST00000517419.5,ENST00000521361.5,ENST00000523570.5,ENST00000487824.2,ENST00000462856.6,ENST00000524310.5,ENST00000518630.5,ENST00000368667.6,ENST00000521062.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000520518.5	ENSG00000010810.17	FYN	protein_coding	intron-3
ENST00000518295.5	ENSG00000010810.17	FYN	protein_coding	intron-3
ENST00000523322.5	ENSG00000010810.17	FYN	retained_intron	intron-1
ENST00000229471.8	ENSG00000010810.17	FYN	protein_coding	intron-1
ENST00000368678.8	ENSG00000010810.17	FYN	protein_coding	intron-2
ENST00000484067.6	ENSG00000010810.17	FYN	protein_coding	intron-4
ENST00000354650.7	ENSG00000010810.17	FYN	protein_coding	intron-3
ENST00000523238.5	ENSG00000010810.17	FYN	protein_coding	intron-2
ENST00000368682.7	ENSG00000010810.17	FYN	protein_coding	intron-3
ENST00000523574.5	ENSG00000010810.17	FYN	protein_coding	intron-2
ENST00000462598.7	ENSG00000010810.17	FYN	protein_coding	intron-2
ENST00000517419.5	ENSG00000010810.17	FYN	protein_coding	intron-1
ENST00000521361.5	ENSG00000010810.17	FYN	retained_intron	intron-3
ENST00000523570.5	ENSG00000010810.17	FYN	protein_coding	intron-2
ENST00000487824.2	ENSG00000010810.17	FYN	protein_coding	intron-3
ENST00000462856.6	ENSG00000010810.17	FYN	protein_coding	utr5-1
ENST00000524310.5	ENSG00000010810.17	FYN	protein_coding	intron-2
ENST00000518630.5	ENSG00000010810.17	FYN	protein_coding	intron-3
ENST00000368667.6	ENSG00000010810.17	FYN	protein_coding	intron-2
ENST00000521062.5	ENSG00000010810.17	FYN	protein_coding	intron-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 31597913, 27371828

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.