| mod ID | m6A_site_735285 | mod Site | chr6:137198174-137198175:- | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGTGAAATAAAAACAGAAGGACAAGAGCTCATAACCGTAAT |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
............................... |
MFE | 0.00 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 13 | Support sub-Dataset Num | 29 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2991416, GSM2884199, GSM3396437, GSM3396438, GSM3582047, GSM3582048, GSM3582049, GSM3582054, GSE129842, GSM928399, GSM928401, GSM1135032, GSM1135033, GSM1339393, GSM1339395, GSM1339403, GSM1339405, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1723347, GSM1723349, GSM1723351, GSM1828594, GSM1828596, GSM2203064, GSM2460354, GSM2602070 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, A549, hESC-HEK293T, hNPCs, hESCs, fibroblasts, LCLs, CD8T, Huh7, MSC, AML |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq,m6A-CLIP/IP,miCLIP | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000646898.1,ENST00000646036.1,ENST00000644894.1,ENST00000642390.1,ENST00000645753.1,ENST00000643119.1,ENST00000645045.1,ENST00000367739.8,ENST00000647124.1 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | panTro5:m6A_site_58264;rheMac8:m6A_site_44584;susScr11:m6A_site_1396 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1