| mod ID | m6A_site_744516 | mod Site | chr7:1086975-1086976:+ | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGGGCTGGCGGTGCCTGAGGACCCCTTCGGCCTGGACAGCC |
|||||||||||||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||||||||||||
| RNA Structure Motif |
...(((.(((.((((...)))).)))))).. |
MFE | -11.20 | |||||||||||||||||||||||
| Support Dataset Num | 4 | Support sub-Dataset Num | 9 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2987449, GSM3582046, GSM3582047, GSM2332977, GSM2332978 |
|||||||||||||||||||||||||
| Cell/Tissue List | HeLa, HepG2, GSC-11 | |||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000413368.5,ENST00000297469.3,ENST00000397092.5,ENST00000401670.1 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1