| mod ID | m6A_site_747106 | mod Site | chr7:5605637-5605638:+ | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCCACCTGTCGCCCCTATGGACTCCCCACTCTCCCCTCCGC |
|||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||
| RNA Structure Motif |
..(((.........))).............. |
MFE | -1.80 | |||||||||||||
| Support Dataset Num | 13 | Support sub-Dataset Num | 42 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739522, GSM2739523, GSM2991399, GSM2991400, GSM2991403, GSM2987447, GSM2987448, GSM4024125, GSM908329, GSM908331, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339395, GSM1339403, GSM1339425, GSM1339429, GSM1339439, GSM1723349, GSM1982257, GSM1982263, GSM2010454, GSM2010456, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2754213, GSM2754220, GSM2754235, GSM2754244, GSM2754246, GSM2602070 |
|||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, H1A, H1B, hESCs, fibroblasts, A549, LCLs, H1299, MM6, MSC, TIME, iSLK, AML |
|||||||||||||||
| Seq Type List | m6A-seq,DART-seq,MeRIP-seq,miCLIP | |||||||||||||||
| Transcript ID List | ENST00000473330.1,ENST00000382361.8 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | mm10:m6A_site_490715 | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1