RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_749121

mod Site

chr7:16661241-16661242:+

mod Type

m6A

Sequence

GCAGTCATTCCCTTGTAGGGACAACTAGAAGGTAAGTCCTC

Motif Score

3.64304761904762

RNA Structure Motif

.....((((.(((......))).))))....

MFE

-8.50

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE125803, GSE37003, GSE46705, GSE55572, GSE74016, GSE90914, GSE93676

Support sub-Dataset List

GSM2739506, GSM2991403, GSM3582048, GSM908337, GSM1135020, GSM1135021, GSM1339403, GSM1339405, GSM1339425, GSM1339427, GSM1339439, GSM1908208, GSM2417479, GSM2460345, GSM2460352, GSM2460354, GSM2754224, GSM2754238

Cell/Tissue List

HeLa, HepG2, fibroblasts, A549, MT4, HEK293A-TOA, iSLK, MSC, TIME

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000432311.5,ENST00000630952.2,ENST00000437745.5,ENST00000452975.6,ENST00000405202.5,ENST00000415365.5,ENST00000446596.5,ENST00000433922.6,ENST00000480517.5,ENST00000436868.5,ENST00000258761.8

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000432311.5	ENSG00000136261.15	BZW2	processed_transcript	intron-1
ENST00000630952.2	ENSG00000136261.15	BZW2	protein_coding	intron-1
ENST00000437745.5	ENSG00000136261.15	BZW2	nonsense_mediated_decay	intron-1
ENST00000452975.6	ENSG00000136261.15	BZW2	protein_coding	utr5-1
ENST00000405202.5	ENSG00000136261.15	BZW2	protein_coding	intron-1
ENST00000415365.5	ENSG00000136261.15	BZW2	protein_coding	intron-1
ENST00000446596.5	ENSG00000136261.15	BZW2	protein_coding	utr5-1
ENST00000433922.6	ENSG00000136261.15	BZW2	protein_coding	intron-1
ENST00000480517.5	ENSG00000136261.15	BZW2	retained_intron	exon-1
ENST00000436868.5	ENSG00000136261.15	BZW2	nonsense_mediated_decay	intron-1
ENST00000258761.8	ENSG00000136261.15	BZW2	protein_coding	intron-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755, 31597913, 22575960, 24284625, 24981863, 27572442, 28525753, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.