| mod ID | m6A_site_750379 | mod Site | chr7:23312385-23312386:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAGAAGGCTCTGCAAAGTGGACCACCTCAGTCAAGACGGAA |
|||||||||||||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||||||||||||
| RNA Structure Motif |
((.(((((...)))))))............. |
MFE | -4.70 | |||||||||||||||||||||||
| Support Dataset Num | 15 | Support sub-Dataset Num | 39 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739523, GSM2739535, GSM3396437, GSM3396438, GSM3582052, GSM3582053, GSM928399, GSM928401, GSM928403, GSM1135032, GSM1135033, GSM1272358, GSM1272360, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1982263, GSM2010454, GSM2203051, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2324292, GSM2332975, GSM2332977, GSM2464927, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, H1A, H1B, hNPCs, hESCs, fibroblasts, H1299, MM6, Huh7, Jurkat, peripheral-blood, GSC-11, HEC-1-A, NB4 |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000619562.4,ENST00000498363.1,ENST00000421467.6,ENST00000258729.8 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_503537;panTro5:m6A_site_59243;rheMac8:m6A_site_39782 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1