| mod ID | m6A_site_754023 | mod Site | chr7:36389891-36389892:+ | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTGGAAGCCGAGAGGAGAGGACAGCTGGTTGTGGGAGAGTT |
|||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||
| RNA Structure Motif |
((((.((..(......)..))))))...... |
MFE | -3.40 | |||||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 21 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739522, GSM2739534, GSM3083805, GSM3083809, GSM3083810, GSM908331, GSM908337, GSM1272366, GSM1339429, GSM2283210, GSM2283211, GSM2283213, GSM2417479, GSM2460350, GSM2460352, GSM2460354, GSM2754213, GSM2464927, GSM2464931 |
|||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, H1A, A549, Jurkat, HEK293A-TOA, iSLK, MSC, HEC-1-A |
|||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||
| Transcript ID List | ENST00000265748.7,ENST00000396068.6 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | na | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1