| mod ID | m6A_site_754828 | mod Site | chr7:40093062-40093063:+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCATCCAGCCTAAAGTGGAGACTGATGCTGCCCAGGCGGCT |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
((((....(((....)))...))))...... |
MFE | -5.80 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 20 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2884195, GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSM1135020, GSM1135021, GSM1135032, GSM1339395, GSM1339425, GSM1594131, GSM2010454, GSM2283211, GSM2283213, GSM2324298, GSM2460345, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, hESCs, A549, GM12878, MM6, Jurkat, peripheral-blood, iSLK, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000340829.10,ENST00000644561.1,ENST00000478563.2,ENST00000181839.10,ENST00000643915.1,ENST00000643859.1,ENST00000646039.1,ENST00000644221.1,ENST00000465643.1,ENST00000645826.1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_154614;panTro5:m6A_site_59497;rn6:m6A_site_43601 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1