| mod ID | m6A_site_757162 | mod Site | chr7:45913392-45913393:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TTTAAACCCCGGTCATCCGGACATCCCAACGCATGCTCCTG |
|||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||
| RNA Structure Motif |
...((((....))))................ |
MFE | -6.50 | |||||||||||||||||||||||
| Support Dataset Num | 15 | Support sub-Dataset Num | 54 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2991403, GSM2987449, GSE125240, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSM908329, GSM908331, GSM908333, GSM908335, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1339393, GSM1339403, GSM1339405, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM1982257, GSM2010454, GSM2203047, GSM2203056, GSM2203060, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754235, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2464919, GSM2464931 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, liver, A549, hNPCs, fibroblasts, GM12878, MM6, Huh7, HEK293A-TOA, iSLK, MSC, endometrial, HEC-1-A |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,m6A-REF-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000613132.4,ENST00000381083.9,ENST00000381086.9,ENST00000275521.10 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_79185 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1