Details of RNA Modification Site of hg38
mod ID m6A_site_760969 mod Site chr7:73831637-73831638:+
mod Type m6A Sequence GGCCCACAACATCATCCAAGACTTCTACAATCCGCTGGTGG
Motif Score 3.31938095238095
RNA Structure Motif ...............................
 MFE 0.00
Support Dataset Num 8 Support sub-Dataset Num 27
Support Dataset List
Support sub-Dataset List

GSM2739506, GSM2739522, GSM2739534, GSM2739535, GSM2987447, GSM2987449, GSM3582046, GSM3582047, GSM3582052, GSM3582053, GSM3582054, GSM908337, GSM1272360, GSM1272368, GSM1339395, GSM2460360, GSM2754222, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464921, GSM2464923, GSM2464927, GSM2464931
Cell/Tissue List

HeLa, HepG2, A549, H1B, hESCs, TREX, TIME, endometrial, HEC-1-A
Seq Type List m6A-seq,MeRIP-seq
Transcript ID List ENST00000435050.1,ENST00000340958.3,ENST00000431918.1
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000435050.1ENSG00000189143.9CLDN4protein_codingcds-2
ENST00000340958.3ENSG00000189143.9CLDN4protein_codingcds-1
ENST00000431918.1ENSG00000189143.9CLDN4protein_codingcds-2
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1