| mod ID | m6A_site_765296 | mod Site | chr7:93131945-93131946:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AGAGCAGATAGGTTTGCTGGACTCTTGGAATATCTTAATCC |
|||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||
| RNA Structure Motif |
((((((((((...))))).......))))). |
MFE | -1.10 | |||||||||||||||||||||||
| Support Dataset Num | 5 | Support sub-Dataset Num | 10 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM1339405, GSM1339427, GSM1723347, GSM1723349, GSM1723351, GSM1828594, GSM2010454, GSM2460352, GSM2460358, GSM2460362 |
|||||||||||||||||||||||||
| Cell/Tissue List |
fibroblasts, A549, LCLs, CD8T, MM6, MSC, TIME, TREX |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,m6A-CLIP/IP,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000411955.5,ENST00000610760.1,ENST00000318238.9,ENST00000437805.5 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_494743;panTro5:m6A_site_59890;rheMac8:m6A_site_40176 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1