| mod ID | m6A_site_765308 | mod Site | chr7:93132678-93132679:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TTTCTACATTAAAGAGAAGGACTTTAACACAGCTCTGGACT |
|||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||
| RNA Structure Motif |
.......((((..(..........)..)))) |
MFE | -2.00 | |||||||||||||||||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 32 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM3582046, GSM3582047, GSM3582052, GSM908335, GSM908337, GSM1166139, GSM1339403, GSM1339405, GSM1594131, GSM1723347, GSM1723349, GSM1723351, GSM1828594, GSM2010454, GSM2010456, GSM2283214, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2460362, GSM2754214, GSM2754216, GSM2754222, GSM2754224, GSM2754240, GSM2754246, GSM2754248, GSM2564019, GSM2564022 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, A549, HepG2, U2OS, fibroblasts, GM12878, LCLs, CD8T, MM6, CD4T, iSLK, MSC, TIME, TREX, NB4 |
|||||||||||||||||||||||||
| Seq Type List | MeRIP-seq,m6A-seq,m6A-CLIP/IP | |||||||||||||||||||||||||
| Transcript ID List | ENST00000411955.5,ENST00000318238.9,ENST00000610760.1,ENST00000437805.5 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_494754;rheMac8:m6A_site_40185 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1