Details of RNA Modification Site of hg38
mod ID m6A_site_765578 mod Site chr7:94430334-94430335:+
mod Type m6A Sequence CCTTGATATTGCACCTTTGGACATCGGTGGTGCTGACCAGG
Motif Score 3.64304761904762
RNA Structure Motif .....(((((.(((.....))).)))))...
 MFE -8.80
Support Dataset Num 2 Support sub-Dataset Num 6
Support Dataset List GSE125240, GSE55572
Support sub-Dataset List

GSE125240, GSM1339393, GSM1339395, GSM1339403, GSM1339405, GSM1339407
Cell/Tissue List kidney, hNPCs, hESCs, fibroblasts
Seq Type List m6A-REF-seq,m6A-seq
Transcript ID List ENST00000464916.1,ENST00000297268.10,ENST00000620463.1,ENST00000481570.5
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000464916.1ENSG00000164692.17COL1A2retained_intronexon-4
ENST00000297268.10ENSG00000164692.17COL1A2protein_codingcds-52
ENST00000620463.1ENSG00000164692.17COL1A2protein_codingcds-52
ENST00000481570.5ENSG00000164692.17COL1A2retained_intronexon-8
Conserved Sites mm10:m6A_site_495002
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID 31281898, 24981863

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1