| mod ID | m6A_site_777945 | mod Site | chr7:134935702-134935703:+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AAAAGGGAGAAGAGAAGGGAACTAAAGTGCAAGCTAAAAGA |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....................(((....))). |
MFE | -0.40 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 8 | Support sub-Dataset Num | 35 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739507, GSM2987449, GSM3396437, GSM3396438, GSM928399, GSM928401, GSM1339393, GSM1339395, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203052, GSM2203055, GSM2203056, GSM2203059, GSM2203060, GSM2203063, GSM2203064, GSM2754224, GSM2464907, GSM2464909, GSM2464911, GSM2464915, GSM2464917, GSM2464919, GSM2464931 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, hNPCs, hESCs, fibroblasts, A549, Huh7, TIME, endometrial, HEC-1-A |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000443197.5,ENST00000422748.5,ENST00000393118.6,rmsk_2381014,ENST00000424922.5,ENST00000361675.7,ENST00000436461.6,ENST00000482470.5,ENST00000361901.6,ENST00000417172.5,ENST00000430085.5,ENST00000495522.1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1