Details of RNA Modification Site of hg38
mod ID m6A_site_780227 mod Site chr7:140694893-140694894:+
mod Type m6A Sequence TGGGACGTTTTAAAATTGGGACACCAATTTCAAATGTAACC
Motif Score 3.64304761904762
RNA Structure Motif (((((..(((((((....))))))).)))))
 MFE -7.00
Support Dataset Num 4 Support sub-Dataset Num 5
Support Dataset List
Support sub-Dataset List

GSM3396438, GSE129842, GSM928399, GSM1339429, GSM1339439
Cell/Tissue List HEK293T, hESC-HEK293T, A549
Seq Type List MeRIP-seq,MAZTER-seq,m6A-seq
Transcript ID List ENST00000473512.1,ENST00000482954.5,ENST00000072869.9,ENST00000483369.5,ENST00000476491.5
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000473512.1ENSG00000133597.11ADCK2protein_codingutr3-5
ENST00000482954.5ENSG00000090266.13NDUFB2protein_codingintron-1
ENST00000072869.9ENSG00000133597.11ADCK2protein_codingutr3-8
ENST00000483369.5ENSG00000133597.11ADCK2protein_codingintron-7
ENST00000476491.5ENSG00000133597.11ADCK2protein_codingintron-7
Conserved Sites na
snoRNA Num 0 snoRNA Guide Site na
snoRNA Guide Detail na
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID 31257032, 22608085, 24981863

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.

© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1