| mod ID | m6A_site_780256 | mod Site | chr7:140696816-140696817:+ | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TCAGAAGCGGCTGCGCACGGACTGCTGGAGATGGTGGAGTC |
|||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
((((((((....))).))))).......... |
MFE | -7.80 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 15 | Support sub-Dataset Num | 37 | |||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739522, GSM2739535, GSM2987448, GSM2987449, GSM3083809, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSM908337, GSM1272368, GSM1339403, GSM1339405, GSM1339427, GSM1339429, GSM1339439, GSM1982257, GSM2010456, GSM2283211, GSM2324292, GSM2324298, GSM2324308, GSM2332975, GSM2332986, GSM2460348, GSM2460352, GSM2460354, GSM2460360, GSM2460362, GSM2754213, GSM2754226, GSM2464905, GSM2464909, GSM2464911 |
|||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, A549, H1B, fibroblasts, MM6, Jurkat, peripheral-blood, GSC-11, HEK293T, iSLK, MSC, TREX, endometrial |
|||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000461457.1,ENST00000476181.5,ENST00000464566.5,ENST00000476279.5,ENST00000465506.5,ENST00000464564.6,ENST00000247866.9,ENST00000482954.5 | |||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1