| mod ID | m6A_site_783835 | mod Site | chr7:152148818-152148819:- | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
ATATTGTAATCCCTAAGGGGACATTTAAACCACCTTGTGAG |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....((((....))))............... |
MFE | -5.50 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 19 | Support sub-Dataset Num | 40 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739503, GSM2739522, GSM2739523, GSM2991403, GSM2884195, GSM2884197, GSM3396437, GSM3396438, GSE129842, GSM928399, GSM928401, GSM928403, GSM908333, GSM908337, GSM1135032, GSM1339403, GSM1339407, GSM1339427, GSM1594131, GSM1723347, GSM1723349, GSM1723351, GSM1828594, GSM2010454, GSM2203052, GSM2203060, GSM2283211, GSM2324298, GSM2324308, GSM2324310, GSM2417477, GSM2417478, GSM2460347, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, hESC-HEK293T, HepG2, fibroblasts, A549, GM12878, LCLs, CD8T, MM6, Huh7, Jurkat, peripheral-blood, HEK293A-TOA, iSLK, endometrial |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq,m6A-CLIP/IP | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000262189.11,ENST00000424877.5,ENST00000473186.5,ENST00000355193.6,ENST00000360104.7,ENST00000558084.5 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_453671;rheMac8:m6A_site_41461 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1