| mod ID | m6A_site_783984 | mod Site | chr7:152181019-152181020:- | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAGACACCTAGGCCCCCTGGACCTGGTCTTTCAGACACATT |
||||||||||||||||||||||||||||
| Motif Score | 3.62240476190476 | ||||||||||||||||||||||||||||||
| RNA Structure Motif |
..(((((((....)).))))).......... |
MFE | -7.60 | ||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 34 | ||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739507, GSM2991403, GSM2884195, GSM2884197, GSM2884199, GSM3396437, GSM3396438, GSM928399, GSM928401, GSM908337, GSM1135021, GSM1135032, GSM1135033, GSM1339401, GSM1339403, GSM1339427, GSM1594131, GSM2203047, GSM2203060, GSM2417478, GSM2417479, GSM2460345, GSM2460352, GSM2460354, GSM2460356, GSM2460360, GSM2460362, GSM2754214, GSM2754216, GSM2754224, GSM2754226, GSM2754246 |
||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HEK293T, HepG2, fibroblasts, A549, GM12878, Huh7, HEK293A-TOA, iSLK, MSC, TIME, TREX |
||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000355193.6,ENST00000558084.5,ENST00000558665.1,ENST00000473186.5,ENST00000262189.11 | ||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||
| Conserved Sites | susScr11:m6A_site_58933 | ||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1