| mod ID | m6A_site_78750 | mod Site | chr1:214642125-214642126:+ | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AGAAATTAGTGGCCTTAAAGACTGTGAAATAGATGCGGAAG |
||||||||
| Motif Score | 3.31938095238095 | ||||||||||
| RNA Structure Motif |
.((((..........))))............ |
MFE | -0.40 | ||||||||
| Support Dataset Num | 12 | Support sub-Dataset Num | 34 | ||||||||
| Support Dataset List | |||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739507, GSM2991416, GSM3396437, GSM3396438, GSM3582048, GSM3582054, GSM928399, GSM928401, GSM908333, GSM908335, GSM1135032, GSM1135033, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339439, GSM1594131, GSM1723347, GSM1723351, GSM2010454, GSM2203044, GSM2203052, GSM2203056, GSM2203060, GSM2203063, GSM2203064, GSM2460347 |
||||||||||
| Cell/Tissue List |
HeLa, HEK293T, A549, HepG2, hNPCs, hESCs, fibroblasts, GM12878, LCLs, MM6, Huh7, iSLK |
||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||
| Transcript ID List | ENST00000366955.8 | ||||||||||
| Transcript Detail |
|
||||||||||
| Conserved Sites | mm10:m6A_site_42434;panTro5:m6A_site_6640;rheMac8:m6A_site_4838;rn6:m6A_site_31514;susScr11:m6A_site_139172 | ||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||
| snoRNA Guide Detail | na | ||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||
| Writer Catalysis Detail | na | ||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1