RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_795714

mod Site

chr8:42320941-42320942:+

mod Type

m6A

Sequence

ACCCTCAGTGGCTGTGCGGGACCATTCTCTAGAGCATGCTT

Motif Score

3.62240476190476

RNA Structure Motif

.....(((.((.((((....)))))).))).

MFE

-7.50

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493

Support sub-Dataset List

GSM2739506, GSM2739535, GSM2991403

Cell/Tissue List

HeLa

Seq Type List

m6A-seq

Transcript ID List

ENST00000342222.6,ENST00000520655.5,ENST00000520201.5,ENST00000517890.5,ENST00000519938.5,ENST00000629753.1,ENST00000416505.6,ENST00000521661.5,ENST00000523105.5,ENST00000523599.2,ENST00000648136.1,ENST00000520835.7,ENST00000523517.5,ENST00000518679.5,ENST00000522147.4,ENST00000520810.6,ENST00000649612.2

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000342222.6	ENSG00000104365.15	IKBKB	nonsense_mediated_decay	intron-16
ENST00000520655.5	ENSG00000104365.15	IKBKB	nonsense_mediated_decay	intron-14
ENST00000520201.5	ENSG00000104365.15	IKBKB	retained_intron	intron-13
ENST00000517890.5	ENSG00000104365.15	IKBKB	nonsense_mediated_decay	intron-15
ENST00000519938.5	ENSG00000104365.15	IKBKB	retained_intron	exon-1
ENST00000629753.1	ENSG00000104365.15	IKBKB	protein_coding	intron-15
ENST00000416505.6	ENSG00000104365.15	IKBKB	protein_coding	intron-15
ENST00000521661.5	ENSG00000104365.15	IKBKB	nonsense_mediated_decay	intron-15
ENST00000523105.5	ENSG00000104365.15	IKBKB	nonsense_mediated_decay	intron-14
ENST00000523599.2	ENSG00000104365.15	IKBKB	retained_intron	intron-2
ENST00000648136.1	ENSG00000104365.15	IKBKB	retained_intron	intron-6
ENST00000520835.7	ENSG00000104365.15	IKBKB	protein_coding	intron-15
ENST00000523517.5	ENSG00000104365.15	IKBKB	nonsense_mediated_decay	intron-15
ENST00000518679.5	ENSG00000104365.15	IKBKB	nonsense_mediated_decay	intron-10
ENST00000522147.4	ENSG00000104365.15	IKBKB	protein_coding	intron-1
ENST00000520810.6	ENSG00000104365.15	IKBKB	protein_coding	intron-16
ENST00000649612.2	ENSG00000104365.15	IKBKB	protein_coding	intron-16

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

29507755

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.