| mod ID | m6A_site_800969 | mod Site | chr8:75223762-75223763:- | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCTAAAATTATAAGACAAAGACTTCAAAATAGCTATTTTAA |
||||||||||||||||||
| Motif Score | 3.31938095238095 | ||||||||||||||||||||
| RNA Structure Motif |
............................... |
MFE | 0.00 | ||||||||||||||||||
| Support Dataset Num | 5 | Support sub-Dataset Num | 8 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM3396437, GSM3396438, GSM3582046, GSM928399, GSM1339393, GSM1339439, GSM2203056, GSM2203060 |
||||||||||||||||||||
| Cell/Tissue List | HEK293T, HeLa, hNPCs, A549, Huh7 | ||||||||||||||||||||
| Seq Type List | MeRIP-seq,m6A-seq | ||||||||||||||||||||
| Transcript ID List | rmsk_2552666,ENST00000522183.1,ENST00000504531.2 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1