RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_802755

mod Site

chr8:90006243-90006244:+

mod Type

m6A

Sequence

CACAGTAGGGAGATGTCAGGACTGGGGAAGAAGCATCTCCT

Motif Score

4.06504166666667

RNA Structure Motif

...............................

MFE

0.00

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE83438, GSE93676

Support sub-Dataset List

GSM2203060, GSM2460356, GSM2460360, GSM2754226

Cell/Tissue List

Huh7, TIME, TREX

Seq Type List

MeRIP-seq

Transcript ID List

ENST00000518725.5,ENST00000517761.5,ENST00000520227.1,ENST00000519007.5,ENST00000519328.5,ENST00000517314.5,ENST00000521668.1,ENST00000521603.5,ENST00000517597.5,ENST00000220764.7,ENST00000519410.5,ENST00000523447.5,ENST00000522161.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000518725.5	ENSG00000104325.7	DECR1	nonsense_mediated_decay	intron-1
ENST00000517761.5	ENSG00000104325.7	DECR1	protein_coding	intron-1
ENST00000520227.1	ENSG00000104325.7	DECR1	protein_coding	intron-2
ENST00000519007.5	ENSG00000104325.7	DECR1	processed_transcript	intron-1
ENST00000519328.5	ENSG00000104325.7	DECR1	nonsense_mediated_decay	intron-1
ENST00000517314.5	ENSG00000104325.7	DECR1	nonsense_mediated_decay	intron-1
ENST00000521668.1	ENSG00000104325.7	DECR1	processed_transcript	intron-2
ENST00000521603.5	ENSG00000104325.7	DECR1	nonsense_mediated_decay	intron-1
ENST00000517597.5	ENSG00000104325.7	DECR1	nonsense_mediated_decay	intron-1
ENST00000220764.7	ENSG00000104325.7	DECR1	protein_coding	intron-1
ENST00000519410.5	ENSG00000104325.7	DECR1	protein_coding	intron-2
ENST00000523447.5	ENSG00000104325.7	DECR1	processed_transcript	intron-1
ENST00000522161.5	ENSG00000104325.7	DECR1	protein_coding	cds-3

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

27773535, 29109479

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.