| mod ID | m6A_site_802981 | mod Site | chr8:91960004-91960005:- | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AGATATCTTTTCTTTAGAGAACTGAAAAGAGAGCAGAGAAT |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.37338095238095 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
((((((.(((((....))))))))))).... |
MFE | -5.50 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 5 | Support sub-Dataset Num | 18 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM3396437, GSM3396438, GSM928399, GSM928401, GSM1339393, GSM1339395, GSM1339407, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460360, GSM2754211, GSM2754244 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HEK293T, hNPCs, hESCs, fibroblasts, HEK293A-TOA, iSLK, MSC, TREX |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | MeRIP-seq,m6A-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000436581.6,ENST00000523629.5,ENST00000615601.4,ENST00000614812.4,ENST00000265814.4,ENST00000422361.6,ENST00000360348.6,ENST00000396218.5,ENST00000613886.4,ENST00000613302.4,ENST00000617740.4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_409802;susScr11:m6A_site_89764 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1