RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_805177

mod Site

chr8:100721533-100721534:-

mod Type

m6A

Sequence

GGCCTCGCTCTACGTGGGGGACCTCCACCCCGACGTGACCG

Motif Score

3.62240476190476

RNA Structure Motif

......((((.((((.......)))).))))

MFE

-12.90

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE37002, GSE74016, GSE76367, GSE76414, GSE87190

Support sub-Dataset List

GSM2739502, GSM2739503, GSM2739522, GSM2739534, GSM2987447, GSM2987448, GSM908331, GSM1908208, GSM1908210, GSM1908212, GSM1982257, GSM2010454, GSM2010456, GSM2324298

Cell/Tissue List

HeLa, HepG2, MT4, A549, MM6, peripheral-blood

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000517921.1,ENST00000318607.10,ENST00000520142.1,ENST00000518196.5,ENST00000521067.1,ENST00000521865.5,ENST00000519004.5,ENST00000519363.1,ENST00000523555.5,ENST00000522387.5,ENST00000522720.1,ENST00000520804.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000517921.1	ENSG00000070756.16	PABPC1	retained_intron	exon-1
ENST00000318607.10	ENSG00000070756.16	PABPC1	protein_coding	cds-1
ENST00000520142.1	ENSG00000070756.16	PABPC1	protein_coding	cds-2
ENST00000518196.5	ENSG00000070756.16	PABPC1	protein_coding	intron-1
ENST00000521067.1	ENSG00000070756.16	PABPC1	protein_coding	cds-3
ENST00000521865.5	ENSG00000070756.16	PABPC1	protein_coding	cds-3
ENST00000519004.5	ENSG00000070756.16	PABPC1	protein_coding	intron-1
ENST00000519363.1	ENSG00000070756.16	PABPC1	protein_coding	cds-2
ENST00000523555.5	ENSG00000070756.16	PABPC1	protein_coding	cds-1
ENST00000522387.5	ENSG00000070756.16	PABPC1	protein_coding	cds-2
ENST00000522720.1	ENSG00000070756.16	PABPC1	protein_coding	cds-2
ENST00000520804.1	ENSG00000070756.16	PABPC1	protein_coding	cds-2

Conserved Sites

mm10:m6A_site_204595

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15	RBM15:CH77767	chr8:100721532-100721552	SBDH684-62617

PubMed ID

29507755, 3086759, 22575960, 27572442, 27117702, 28017614, 29249359

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.