| mod ID | m6A_site_811022 | mod Site | chr8:140659004-140659005:- | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
ACCATAGAATTATTATCCAGACTGGAATTTTTGTTTGTTAG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.31938095238095 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
..........((((...)))).......... |
MFE | -2.20 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 31 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739523, GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM4024128, GSM3582047, GSM3582048, GSM928399, GSM928401, GSM928403, GSM1135032, GSM1339393, GSM1339395, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339439, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460354, GSM2460356, GSM2460358, GSM2464919, GSM2464931 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, hNPCs, hESCs, fibroblasts, A549, HEK293A-TOA, iSLK, MSC, TIME, endometrial, HEC-1-A |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,DART-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000519419.5,ENST00000395218.3,ENST00000340930.7,ENST00000517887.5,ENST00000519654.5,ENST00000519465.5,ENST00000521059.5,ENST00000519993.5,ENST00000522684.5,ENST00000517712.5,ENST00000523539.5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_208824;rheMac8:m6A_site_55935;susScr11:m6A_site_88513 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1