| mod ID | m6A_site_817176 | mod Site | chr9:19376343-19376344:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAAATTGCGAAGAGACGCAGACTTTCCTCTCTGCGAGCTTC |
|||||||||||||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||||||||||||
| RNA Structure Motif |
..........((((((........)))))). |
MFE | -8.20 | |||||||||||||||||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 15 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2991403, GSM3396437, GSM3396438, GSM3900734, GSM928401, GSM908331, GSM1339393, GSM1339403, GSM1339405, GSM1339407, GSM1723349, GSM1723351, GSM1982257, GSM1982263, GSM2203048 |
|||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, BGC823, HepG2, hNPCs, fibroblasts, LCLs, A549, H1299, Huh7 |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000498815.1,ENST00000315377.4,ENST00000380384.5,ENST00000380394.8 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | panTro5:m6A_site_63552;rheMac8:m6A_site_21943 | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1