| mod ID | m6A_site_821866 | mod Site | chr9:37086812-37086813:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GAGCCAAGTGGCAAATTTGGACAGTATCCATCGATGCAGAT |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
............((((.....))))...... |
MFE | -2.50 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 23 | Support sub-Dataset Num | 73 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884197, GSM2987449, GSM3396437, GSM3396438, GSE125240, GSM3582046, GSM3582047, GSM3582048, GSM3582049, GSM3582052, GSM3582053, GSM3582054, GSE129842, GSM928399, GSM928401, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1166139, GSM1166140, GSM1166141, GSM1166142, GSM1166143, GSM1166144, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM1723347, GSM1723349, GSM1723351, GSM1828594, GSM1982263, GSM2010454, GSM2203052, GSM2203060, GSM2203063, GSM2203064, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2283214, GSM2324298, GSM2324310, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2460360, GSM2754216, GSM2564019 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, HEK293T, A549, hESC-HEK293T, U2OS, hNPCs, hESCs, fibroblasts, GM12878, LCLs, CD8T, H1299, MM6, Huh7, Jurkat, CD4T, peripheral-blood, HEK293A-TOA, iSLK, MSC, TIME, TREX, NB4 |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-REF-seq,MAZTER-seq,m6A-CLIP/IP | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000625218.1,ENST00000628924.1,ENST00000631093.1,ENST00000627197.1,ENST00000629870.1,ENST00000625445.1 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15 | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1