| mod ID | m6A_site_825221 | mod Site | chr9:78329261-78329262:+ | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AACTCTGTAAAGCTGGTGGGACCTAATGTCACCTTAATTCT |
|||||||||||||
| Motif Score | 3.62240476190476 | |||||||||||||||
| RNA Structure Motif |
.........(((((.(.....).)))))... |
MFE | -5.40 | |||||||||||||
| Support Dataset Num | 13 | Support sub-Dataset Num | 31 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM2739507, GSM2991416, GSM3396437, GSM3396438, GSM928399, GSM908333, GSM908337, GSM1135032, GSM1135033, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM1594131, GSM1723351, GSM1828596, GSM2203063, GSM2203064, GSM2460345, GSM2460347, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2564022 |
|||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, HepG2, hNPCs, hESCs, fibroblasts, A549, GM12878, LCLs, Huh7, iSLK, MSC, TIME, MM6 |
|||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-CLIP/IP | |||||||||||||||
| Transcript ID List | ENST00000376588.4,ENST00000347159.6 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | mm10:m6A_site_309393;panTro5:m6A_site_64113;rheMac8:m6A_site_22246;rn6:m6A_site_11244 | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1