| mod ID | m6A_site_826471 | mod Site | chr9:87731131-87731132:+ | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GTGGACGGTGATGAGGAAGGACTTGACTGGGGATGGCGCAT |
||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||
| RNA Structure Motif |
((((...(((......))).))))....... |
MFE | -3.80 | ||||||||||||||||||
| Support Dataset Num | 16 | Support sub-Dataset Num | 34 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2991403, GSM2987449, GSM3396438, GSM4024128, GSM928399, GSM908331, GSM1135032, GSM1339405, GSM1339425, GSM1339427, GSM1339439, GSM1828596, GSM1982257, GSM1982263, GSM2010454, GSM2010456, GSM2203047, GSM2203051, GSM2203056, GSM2283214, GSM2332975, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464927, GSM2464931, GSM2564019 |
||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, HEK293T, fibroblasts, A549, H1299, MM6, Huh7, CD4T, GSC-11, endometrial, HEC-1-A, NB4 |
||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,DART-seq,m6A-CLIP/IP | ||||||||||||||||||||
| Transcript ID List | ENST00000495822.1,ENST00000343150.10,ENST00000340342.10 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | rheMac8:m6A_site_22357 | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1