| mod ID | m6A_site_826985 | mod Site | chr9:89606188-89606189:+ | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TGCCCGAGTGCGGCGTGGAGACTGGCAGGCGGGGGGGGCGC |
|||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||
| RNA Structure Motif |
...(.(.((.((........)).)).).).. |
MFE | -6.70 | |||||||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 28 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM1272358, GSM1272360, GSM1272366, GSM1272368, GSM1339393, GSM1339395, GSM1339401, GSM2283214, GSM2283215, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332988, GSM2332989, GSM2332990, GSM2417477, GSM2417478, GSM2417479, GSM2754222, GSM2754224, GSM2464907, GSM2464913, GSM2464915, GSM2464921, GSM2464923, GSM2464931, GSM2483505 |
|||||||||||||||
| Cell/Tissue List |
H1A, H1B, hNPCs, hESCs, HEK293T, CD4T, GSC-11, HEK293A-TOA, TIME, endometrial, HEC-1-A, GSCs |
|||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||
| Transcript ID List | ENST00000375769.1,ENST00000252506.11 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | mm10:m6A_site_161368;panTro5:m6A_site_64240;rn6:m6A_site_42374 | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1