| mod ID | m6A_site_828983 | mod Site | chr9:95446274-95446275:- | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AAAAGATGCCCTGTGCCAGGACAGCAGTTCATTGTTACTGT |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.(((((((...))))...))).......... |
MFE | -4.70 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 9 | Support sub-Dataset Num | 23 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739507, GSM2739535, GSM3396437, GSM3396438, GSE125240, GSM1272366, GSM1272368, GSM2283210, GSM2283211, GSM2332975, GSM2332977, GSM2332978, GSM2417477, GSM2417478, GSM2417479, GSM2460350, GSM2460360, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HEK293T, brain, kidney, H1A, H1B, Jurkat, GSC-11, HEK293A-TOA, iSLK, TREX, endometrial |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-REF-seq | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000430669.6,ENST00000331920.10,ENST00000418258.5,ENST00000375290.6,ENST00000421141.5,ENST00000375274.6,ENST00000437951.5,ENST00000546744.5,ENST00000429896.6 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | panTro5:m6A_site_64395;rheMac8:m6A_site_22461 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1