| mod ID | m6A_site_843213 | mod Site | chr9:130693897-130693898:+ | |||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GGGGGATACAATCACTACGGACACAGGATTCATGCGGTACG |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....((((.((........))))))...... |
MFE | -0.90 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 15 | Support sub-Dataset Num | 54 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2884197, GSM2987447, GSM2987449, GSM3582047, GSM3582048, GSM3582052, GSM3582053, GSM3582054, GSM1135020, GSM1135033, GSM1339401, GSM1339407, GSM1339425, GSM1339429, GSM1908206, GSM1908208, GSM1908212, GSM1982257, GSM2203047, GSM2283210, GSM2283211, GSM2283212, GSM2283214, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2417479, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460360, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754222, GSM2754224, GSM2754235, GSM2754237, GSM2754238, GSM2754240, GSM2754244, GSM2754246, GSM2754248, GSM2464913, GSM2464923, GSM2464931, GSM2564019 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
CD34, HepG2, HeLa, A549, HEK293T, fibroblasts, MT4, Huh7, Jurkat, CD4T, peripheral-blood, GSC-11, HEK293A-TOA, iSLK, MSC, TIME, TREX, endometrial, HEC-1-A, NB4 |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000372351.7,ENST00000463488.1,ENST00000491115.6,ENST00000372352.7,ENST00000430138.6,ENST00000546165.5,ENST00000495699.2,ENST00000490641.5,ENST00000372350.7,ENST00000372358.10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_331745;susScr11:m6A_site_10922 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1