RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_843662

mod Site

chr9:131197394-131197395:+

mod Type

m6A

Sequence

GACCTGTGGCACCTTCTGGAACTGCTCTTTCCACCACCTCT

Motif Score

3.37338095238095

RNA Structure Motif

((((..((....))..))))...........

MFE

-4.10

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE102493, GSE110320, GSE120229, GSE125803, GSE29714, GSE37002, GSE37003, GSE46705, GSE52600, GSE55572, GSE83438, GSE90914, GSE93676, GSE98623

Support sub-Dataset List

GSM2739502, GSM2739503, GSM2739507, GSM2739522, GSM2739523, GSM2739535, GSM2991403, GSM2987449, GSM3396437, GSM3396438, GSM3582052, GSM3582054, GSM928401, GSM908331, GSM908337, GSM1135020, GSM1135021, GSM1135032, GSM1135033, GSM1272360, GSM1339403, GSM1339425, GSM1339427, GSM1339429, GSM1339439, GSM2203043, GSM2203047, GSM2203051, GSM2203056, GSM2417477, GSM2417478, GSM2417479, GSM2460345, GSM2460347, GSM2460352, GSM2460354, GSM2460356, GSM2602070

Cell/Tissue List

HeLa, HepG2, HEK293T, A549, H1B, fibroblasts, Huh7, HEK293A-TOA, iSLK, MSC, TIME, AML

Seq Type List

m6A-seq,MeRIP-seq,miCLIP

Transcript ID List

ENST00000529286.1,ENST00000470765.5,ENST00000525384.1,ENST00000483497.6,ENST00000411637.6,ENST00000651334.1,ENST00000359428.10,ENST00000451030.5,ENST00000652454.1,ENST00000465486.6,ENST00000453861.6,ENST00000531600.1,ENST00000528114.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000529286.1	ENSG00000126883.17	NUP214	processed_transcript	exon-1
ENST00000470765.5	ENSG00000126883.17	NUP214	processed_transcript	exon-4
ENST00000525384.1	ENSG00000126883.17	NUP214	retained_intron	exon-2
ENST00000483497.6	ENSG00000126883.17	NUP214	protein_coding	cds-4
ENST00000411637.6	ENSG00000126883.17	NUP214	protein_coding	cds-29
ENST00000651334.1	ENSG00000126883.17	NUP214	protein_coding	cds-6
ENST00000359428.10	ENSG00000126883.17	NUP214	protein_coding	cds-29
ENST00000451030.5	ENSG00000126883.17	NUP214	protein_coding	cds-19
ENST00000652454.1	ENSG00000126883.17	NUP214	protein_coding	cds-29
ENST00000465486.6	ENSG00000126883.17	NUP214	processed_transcript	exon-3
ENST00000453861.6	ENSG00000126883.17	NUP214	nonsense_mediated_decay	cds-5
ENST00000531600.1	ENSG00000126883.17	NUP214	protein_coding	cds-2
ENST00000528114.1	ENSG00000126883.17	NUP214	processed_transcript	exon-4

Conserved Sites

mm10:m6A_site_332125;panTro5:m6A_site_65408;rn6:m6A_site_63708

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15	RBM15:CH81086	chr9:131197371-131197397	SBDH828-22020

PubMed ID

29507755, 3086759, 31597913, 22608085, 22575960, 24284625, 25456834, 24981863, 27773535, 28525753, 29109479, 28920958

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.