| mod ID | m6A_site_859840 | mod Site | chrX:51893650-51893651:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCGCTGGCATTTTCTCCTGGACAAGGAGAGAGTGCGGCTGC |
|||||||||||||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.((((((((((((.....)))))))))))). |
MFE | -19.10 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 38 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2987447, GSM2987448, GSM2987449, GSE129842, GSM1272358, GSM1272360, GSM1272362, GSM1272364, GSM1272366, GSM1272368, GSM1339405, GSM1339429, GSM1828596, GSM2010456, GSM2332975, GSM2332977, GSM2332978, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2460354, GSM2460356, GSM2754248, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HepG2, hESC-HEK293T, H1A, H1B, fibroblasts, A549, MM6, GSC-11, HEK293A-TOA, MSC, TIME, endometrial |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MAZTER-seq,m6A-CLIP/IP,MeRIP-seq | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000375772.7,ENST00000470461.1,ENST00000326587.11,ENST00000494718.5,ENST00000375722.5,ENST00000375695.2 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | susScr11:m6A_site_143559 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1