| mod ID | m6A_site_860502 | mod Site | chrX:53403798-53403799:- | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CCGAGAGAGGGAAATGAAAGACTTGAAGGAGAAGATGAACC |
|||||||||||||
| Motif Score | 3.31938095238095 | |||||||||||||||
| RNA Structure Motif |
............................... |
MFE | 0.00 | |||||||||||||
| Support Dataset Num | 15 | Support sub-Dataset Num | 47 | |||||||||||||
| Support Dataset List | ||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739506, GSM2739534, GSM2991403, GSM2884195, GSM2884197, GSM2884199, GSM2987449, GSM3396437, GSM908331, GSM908335, GSM1339403, GSM1339407, GSM1339427, GSM1723347, GSM1723351, GSM1982263, GSM2010454, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203055, GSM2203056, GSM2203059, GSM2203060, GSM2203063, GSM2203064, GSM2283210, GSM2283212, GSM2283213, GSM2283214, GSM2283215, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332990, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464919, GSM2564019, GSM2564022 |
|||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, HEK293T, fibroblasts, A549, LCLs, H1299, MM6, Huh7, Jurkat, CD4T, peripheral-blood, endometrial, NB4 |
|||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | |||||||||||||||
| Transcript ID List | ENST00000322213.8,ENST00000375340.10 | |||||||||||||||
| Transcript Detail |
|
|||||||||||||||
| Conserved Sites | mm10:m6A_site_671317;rheMac8:m6A_site_59792 | |||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||
| writer Num | 0 | Writer Name List | na | |||||||||||||
| Writer Catalysis Detail | na | |||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1