RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_864419

mod Site

chrX:73820840-73820841:-

mod Type

m6A

Sequence

AAAGCTAAGATAAATGGAAGACTCTTGAACTTGTGAACTGA

Motif Score

3.31938095238095

RNA Structure Motif

(((((............))))).........

MFE

-0.30

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE107954, GSE120229, GSE29714, GSE55572, GSE65380, GSE70299, GSE83438, GSE90914, GSE93676, GSE94808

Support sub-Dataset List

GSM2884199, GSM3396437, GSM3396438, GSM928399, GSM928401, GSM1339401, GSM1594131, GSM1723347, GSM1723349, GSM1723351, GSM2203060, GSM2203063, GSM2203064, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2460354, GSM2483505

Cell/Tissue List

CD34, HEK293T, GM12878, LCLs, Huh7, HEK293A-TOA, MSC, GSCs

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000434839.2,ENST00000650548.1,ENST00000647696.1,ENST00000648607.1,ENST00000421322.2,ENST00000650627.1,ENST00000647913.1,ENST00000416330.2,ENST00000650366.1,ENST00000417942.5,ENST00000429829.6,ENST00000650186.1,ENST00000648829.1

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000434839.2	ENSG00000229807.11	XIST	lincRNA	exon-6
ENST00000650548.1	ENSG00000229807.11	XIST	lincRNA	exon-7
ENST00000647696.1	ENSG00000229807.11	XIST	lincRNA	exon-7
ENST00000648607.1	ENSG00000229807.11	XIST	lincRNA	exon-6
ENST00000421322.2	ENSG00000229807.11	XIST	lincRNA	exon-3
ENST00000650627.1	ENSG00000229807.11	XIST	lincRNA	exon-8
ENST00000647913.1	ENSG00000229807.11	XIST	lincRNA	exon-6
ENST00000416330.2	ENSG00000229807.11	XIST	lincRNA	exon-4
ENST00000650366.1	ENSG00000229807.11	XIST	lincRNA	exon-5
ENST00000417942.5	ENSG00000229807.11	XIST	lincRNA	exon-3
ENST00000429829.6	ENSG00000229807.11	XIST	lincRNA	exon-6
ENST00000650186.1	ENSG00000229807.11	XIST	lincRNA	exon-7
ENST00000648829.1	ENSG00000229807.11	XIST	lincRNA	exon-5

Conserved Sites

mm10:m6A_site_665930

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15B

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15B	RBM15B:CH210638	chrX:73820765-73821025	SBDH685-210638

PubMed ID

30065315, 22608085, 24981863, 25611135, 27773535, 28525753, 29109479, 28297667

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.