RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_864613

mod Site

chrX:73850597-73850598:-

mod Type

m6A

Sequence

GGTGGTGAGCCGTGGCAAGGACCAGAATGGATCACAGATGA

Motif Score

3.62240476190476

RNA Structure Motif

(((.((((((......)))...))).)))..

MFE

-4.90

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE107954, GSE120229, GSE29714, GSE55572, GSE65380, GSE70299, GSE83438, GSE85724, GSE90914, GSE93676, GSE93911, GSE94808

Support sub-Dataset List

GSM2884199, GSM3396437, GSM3396438, GSM928399, GSM928401, GSM928403, GSM1339401, GSM1594131, GSM1723347, GSM1723349, GSM1723351, GSM2203060, GSM2283214, GSM2283215, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2460354, GSM2464901, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2483505

Cell/Tissue List

CD34, HEK293T, GM12878, LCLs, Huh7, CD4T, HEK293A-TOA, MSC, endometrial, GSCs

Seq Type List

m6A-seq,MeRIP-seq

Transcript ID List

ENST00000650637.1,ENST00000635841.1,ENST00000648970.1,ENST00000434839.2,ENST00000650627.1,ENST00000429829.6

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000650637.1	ENSG00000229807.11	XIST	lincRNA	exon-1
ENST00000635841.1	ENSG00000229807.11	XIST	lincRNA	exon-1
ENST00000648970.1	ENSG00000229807.11	XIST	lincRNA	exon-1
ENST00000434839.2	ENSG00000229807.11	XIST	lincRNA	intron-1
ENST00000650627.1	ENSG00000229807.11	XIST	lincRNA	exon-1
ENST00000429829.6	ENSG00000229807.11	XIST	lincRNA	exon-1

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

RBM15B

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
RBM15B	RBM15B:CH210906	chrX:73850585-73850605	SBDH685-210906
RBM15	RBM15:CH83610	chrX:73850596-73850625	SBDH684-67439

PubMed ID

30065315, 22608085, 24981863, 25611135, 27773535, 27371828, 28525753, 29109479, 30154548, 28297667

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.