| mod ID | m6A_site_864623 | mod Site | chrX:73851241-73851242:- | |||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
TCATGGCTTTTGTCACGTGGACATCATGGCGGGCTTGCCGC |
|||||||||||||||||||||||
| Motif Score | 3.64304761904762 | |||||||||||||||||||||||||
| RNA Structure Motif |
(((..((((.....))))....)))...... |
MFE | -6.20 | |||||||||||||||||||||||
| Support Dataset Num | 11 | Support sub-Dataset Num | 34 | |||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2884199, GSM3396437, GSM3396438, GSE125240, GSM928399, GSM928401, GSM928403, GSM1339401, GSM1594131, GSM1723347, GSM1723349, GSM1723351, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203055, GSM2203056, GSM2203059, GSM2203060, GSM2417477, GSM2417478, GSM2417479, GSM2460352, GSM2460354, GSM2754220, GSM2754244, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917 |
|||||||||||||||||||||||||
| Cell/Tissue List |
CD34, HEK293T, GM12878, LCLs, Huh7, HEK293A-TOA, MSC, endometrial |
|||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,m6A-REF-seq | |||||||||||||||||||||||||
| Transcript ID List | ENST00000650627.1,ENST00000650637.1,ENST00000648970.1,ENST00000429829.6 | |||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||
| Conserved Sites | na | |||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | RBM15B | |||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1