| mod ID | m6A_site_871255 | mod Site | chrX:119943735-119943736:- | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GTTTTGCAGAAGTACCCAGAACTGTGTCCAAGGTTTCCTCA |
||||||||
| Motif Score | 3.37338095238095 | ||||||||||
| RNA Structure Motif |
.............(((((........))))) |
MFE | -1.70 | ||||||||
| Support Dataset Num | 5 | Support sub-Dataset Num | 14 | ||||||||
| Support Dataset List | |||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM3582047, GSM1339429, GSM2417479, GSM2460350, GSM2460352, GSM2460356, GSM2460360, GSM2754214 |
||||||||||
| Cell/Tissue List |
HeLa, A549, HEK293A-TOA, iSLK, MSC, TIME, TREX |
||||||||||
| Seq Type List | m6A-seq,MeRIP-seq | ||||||||||
| Transcript ID List | ENST00000371410.5 | ||||||||||
| Transcript Detail |
|
||||||||||
| Conserved Sites | na | ||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||
| snoRNA Guide Detail | na | ||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||
| Writer Catalysis Detail | na | ||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1