| mod ID | m6A_site_87350 | mod Site | chr1:238481316-238481317:- | ||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CAGGAAGCGCTCTAGCAGGGACTCCGGCTTTGCAGAGCATC |
||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
.....(((.((((((.(....)))))))))) |
MFE | -8.00 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 3 | Support sub-Dataset Num | 25 | ||||||||||||||||||||||||||||||||||||||
| Support Dataset List | GSE48037, GSE83438, GSE93676 | ||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM1166141, GSM1166143, GSM2203047, GSM2203051, GSM2203059, GSM2203060, GSM2460345, GSM2460347, GSM2460348, GSM2460350, GSM2460352, GSM2460354, GSM2460356, GSM2460358, GSM2754211, GSM2754213, GSM2754214, GSM2754216, GSM2754220, GSM2754224, GSM2754235, GSM2754237, GSM2754240, GSM2754244, GSM2754246 |
||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List | U2OS, Huh7, iSLK, MSC, TIME | ||||||||||||||||||||||||||||||||||||||||
| Seq Type List | MeRIP-seq | ||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000648188.1,ENST00000648241.1,ENST00000649127.1,ENST00000649385.1,ENST00000400946.3,ENST00000649681.1,rmsk_424661 | ||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | na | ||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||
| PubMed ID | 24209618, 27773535, 29109479 |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1