RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

m6A_site_877889

mod Site

chrX:154412011-154412012:+

mod Type

m6A

Sequence

CATGCCCGGCCGGAGGTGGGACTTAGGGTGGGGGACGCCGC

Motif Score

4.06504166666667

RNA Structure Motif

((.(((.(((......)))..))).))....

MFE

-10.40

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE76414, GSE87515, GSE87516, GSE90914

Support sub-Dataset List

GSM2010456, GSM2332977, GSM2332985, GSM2332986, GSM2332988, GSM2332989, GSM2332990, GSM2417477, GSM2417478, GSM2417479

Cell/Tissue List

MM6, GSC-11, HEK293T, HEK293A-TOA

Seq Type List

m6A-seq

Transcript ID List

ENST00000652682.1,ENST00000612012.5,ENST00000652476.1,ENST00000439735.2,ENST00000614595.2,ENST00000613634.4,ENST00000652390.1,ENST00000601016.6,ENST00000369776.8,ENST00000617701.5,ENST00000475699.6,ENST00000621647.2,ENST00000615658.5,ENST00000652685.1,ENST00000620808.4,ENST00000652358.1,ENST00000612460.5,ENST00000615986.4,ENST00000476800.2,ENST00000613002.4,ENST00000616020.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000652682.1	ENSG00000102125.16	TAZ	nonsense_mediated_decay	intron-1
ENST00000612012.5	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000652476.1	ENSG00000102125.16	TAZ	retained_intron	intron-1
ENST00000439735.2	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000614595.2	ENSG00000102125.16	TAZ	retained_intron	exon-1
ENST00000613634.4	ENSG00000102125.16	TAZ	retained_intron	intron-1
ENST00000652390.1	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000601016.6	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000369776.8	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000617701.5	ENSG00000102125.16	TAZ	nonsense_mediated_decay	intron-1
ENST00000475699.6	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000621647.2	ENSG00000102125.16	TAZ	retained_intron	intron-1
ENST00000615658.5	ENSG00000102125.16	TAZ	retained_intron	intron-1
ENST00000652685.1	ENSG00000102125.16	TAZ	retained_intron	intron-1
ENST00000620808.4	ENSG00000102125.16	TAZ	nonsense_mediated_decay	intron-1
ENST00000652358.1	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000612460.5	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000615986.4	ENSG00000102125.16	TAZ	nonsense_mediated_decay	intron-1
ENST00000476800.2	ENSG00000102125.16	TAZ	retained_intron	intron-1
ENST00000613002.4	ENSG00000102125.16	TAZ	protein_coding	intron-1
ENST00000616020.5	ENSG00000102125.16	TAZ	protein_coding	intron-1

Conserved Sites

mm10:m6A_site_662201

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

Writer Catalysis Detail

PubMed ID

28017614, 28344040, 27773536, 28525753

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.