| mod ID | m6A_site_878416 | mod Site | chrX:154776274-154776275:+ | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
AAAGAAGAAGAGTAAGAAGGACAAGAAGGCCAAAGCTGGTC |
||||||||||||||||||
| Motif Score | 3.64304761904762 | ||||||||||||||||||||
| RNA Structure Motif |
.............((.(......)))..... |
MFE | -0.40 | ||||||||||||||||||
| Support Dataset Num | 17 | Support sub-Dataset Num | 61 | ||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||
| Support sub-Dataset List |
GSM2739506, GSM2739507, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM2991403, GSM2884195, GSM2884197, GSM2884199, GSM2987447, GSM2987449, GSM3396437, GSM3396438, GSE129842, GSM928399, GSM908331, GSM1166139, GSM1339393, GSM1339395, GSM1339401, GSM1339403, GSM1339405, GSM1339407, GSM1339425, GSM1339427, GSM1339439, GSM1723347, GSM1723349, GSM1723351, GSM1982257, GSM1982263, GSM2010454, GSM2010456, GSM2203043, GSM2203044, GSM2203047, GSM2203051, GSM2203052, GSM2203055, GSM2203056, GSM2203059, GSM2203060, GSM2203063, GSM2203064, GSM2283210, GSM2283211, GSM2283212, GSM2283213, GSM2283215, GSM2324298, GSM2324308, GSM2324310, GSM2464905, GSM2464909, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2564019, GSM2564022 |
||||||||||||||||||||
| Cell/Tissue List |
HeLa, CD34, HepG2, HEK293T, hESC-HEK293T, U2OS, hNPCs, hESCs, fibroblasts, A549, LCLs, H1299, MM6, Huh7, Jurkat, CD4T, peripheral-blood, endometrial, NB4 |
||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,MAZTER-seq | ||||||||||||||||||||
| Transcript ID List | ENST00000369550.10,ENST00000492372.1,ENST00000620277.4 | ||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||
| Conserved Sites | rheMac8:m6A_site_60897;susScr11:m6A_site_145569 | ||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1