| mod ID | m6A_site_89533 | mod Site | chr1:247425385-247425386:+ | ||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
CTTCGTGCAAAGGGCCATGGACTATTTCCCCAAGATTGAGA |
||||||||||||||||||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
......(((..(((...)))..)))...... |
MFE | -1.90 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset Num | 10 | Support sub-Dataset Num | 23 | ||||||||||||||||||||||||||||||||||||||||||||||||
| Support Dataset List | |||||||||||||||||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2884195, GSM2884197, GSM1594131, GSM1828594, GSM2010454, GSM2010456, GSM2283214, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2460345, GSM2460347, GSM2460356, GSM2754211, GSM2754235, GSM2754237, GSM2754246, GSM2464907, GSM2464911, GSM2564019, GSM2564022, GSM2602071 |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
CD34, GM12878, CD8T, MM6, CD4T, peripheral-blood, iSLK, TIME, endometrial, NB4, AML |
||||||||||||||||||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,m6A-CLIP/IP,MeRIP-seq,miCLIP | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000643234.1,ENST00000348069.6,ENST00000642259.1,ENST00000366496.6,ENST00000391827.2,ENST00000366497.6,ENST00000336119.7,ENST00000391828.7,ENST00000474792.1 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
||||||||||||||||||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_90536 | ||||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| writer Num | 0 | Writer Name List | na | ||||||||||||||||||||||||||||||||||||||||||||||||
| Writer Catalysis Detail | na | ||||||||||||||||||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1