| mod ID | m6A_site_94162 | mod Site | chr10:17229675-17229676:+ | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| mod Type | m6A | Sequence |
GCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCA |
|||||||||||||||||||||||||||||||||
| Motif Score | 4.06504166666667 | |||||||||||||||||||||||||||||||||||
| RNA Structure Motif |
....((.(.((((((.....))))))))).. |
MFE | -7.50 | |||||||||||||||||||||||||||||||||
| Support Dataset Num | 14 | Support sub-Dataset Num | 44 | |||||||||||||||||||||||||||||||||
| Support Dataset List | ||||||||||||||||||||||||||||||||||||
| Support sub-Dataset List |
GSM2739502, GSM2739503, GSM2739522, GSM2739523, GSM2739534, GSM2739535, GSM908329, GSM908331, GSM1135020, GSM1135021, GSM1908206, GSM1908210, GSM1908212, GSM1982257, GSM1982263, GSM2010454, GSM2010456, GSM2283210, GSM2324292, GSM2324298, GSM2324308, GSM2324310, GSM2332975, GSM2332985, GSM2332986, GSM2332987, GSM2332988, GSM2332989, GSM2332990, GSM2460360, GSM2464905, GSM2464907, GSM2464909, GSM2464911, GSM2464913, GSM2464915, GSM2464917, GSM2464919, GSM2464921, GSM2464923, GSM2564019, GSM2564022, GSM2602070, GSM2602071 |
|||||||||||||||||||||||||||||||||||
| Cell/Tissue List |
HeLa, HepG2, MT4, A549, H1299, MM6, Jurkat, peripheral-blood, GSC-11, HEK293T, TREX, endometrial, NB4, AML |
|||||||||||||||||||||||||||||||||||
| Seq Type List | m6A-seq,MeRIP-seq,miCLIP | |||||||||||||||||||||||||||||||||||
| Transcript ID List | ENST00000224237.9,ENST00000478746.1,ENST00000485947.1,ENST00000544301.7,ENST00000487938.5,ENST00000497849.1 | |||||||||||||||||||||||||||||||||||
| Transcript Detail |
|
|||||||||||||||||||||||||||||||||||
| Conserved Sites | mm10:m6A_site_323725 | |||||||||||||||||||||||||||||||||||
| snoRNA Num | 0 | snoRNA Guide Site | na | |||||||||||||||||||||||||||||||||
| snoRNA Guide Detail | na | |||||||||||||||||||||||||||||||||||
| writer Num | 1 | Writer Name List | METTL3 | |||||||||||||||||||||||||||||||||
| Writer Catalysis Detail |
|
|||||||||||||||||||||||||||||||||||
| PubMed ID |
♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.
♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.
♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.
♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.
♥ Click the "Show Detail" button to show detailed list and click again to hide it.
© 2023, Qu Lab.
School of Life Science,
Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1