RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

Nm_site_1884

mod Site

chr15:55853471-55853472:-

mod Type

Sequence

TCCATTACTCTCGGCCTTTTGGCTAAGATCAAGTATAGTAA

Motif Score

noScore

RNA Structure Motif

...(((.((((....)))).)))........

MFE

-8.20

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE104947, Modomics, snOPY, snoRNABase

Support sub-Dataset List

GSE104947, Modomics, snOPY, snoRNABase

Cell/Tissue List

Seq Type List

RiboMeth-seq

Transcript ID List

ENST00000508871.5,rmsk_4345169,ENST00000648451.1,ENST00000508342.5,ENST00000338963.6,ENST00000506154.1,ENST00000503468.5,ENST00000435532.7

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000508871.5	ENSG00000069869.16	NEDD4	protein_coding	intron-7
rmsk_4345169	rmsk_4345169	U2	snRNA	exon
ENST00000648451.1	ENSG00000069869.16	NEDD4	nonsense_mediated_decay	intron-12
ENST00000508342.5	ENSG00000069869.16	NEDD4	protein_coding	intron-8
ENST00000338963.6	ENSG00000069869.16	NEDD4	protein_coding	intron-5
ENST00000506154.1	ENSG00000069869.16	NEDD4	protein_coding	intron-8
ENST00000503468.5	ENSG00000069869.16	NEDD4	nonsense_mediated_decay	intron-6
ENST00000435532.7	ENSG00000069869.16	NEDD4	protein_coding	intron-12

Conserved Sites

snoRNA Num

snoRNA Guide Site

U2:19

snoRNA Guide Detail

snoRNA Guide Site	snoRNA Guide Base	snoRNA Name	Box	Source Database
U2:19	G	SCARNA9	C/D	snOPY
U2:19	G	SCARNA9	cajalC/D	snoRNABase

writer Num

Writer Name List

FBL,NOP56,NOP58

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
FBL	FBL:CH204768	chr15:55853459-55853485	SBDH120-104023
NOP56	NOP56:CH171101	chr15:55853458-55853485	SBDH121-111002
NOP58	NOP58:CH235500	chr15:55853454-55853486	SBDH124-171117

PubMed ID

29048444, 29106616, 24148649, 16381836

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.