Details of RNA Modification Site of hg38
mod ID Nm_site_1955 mod Site chr15:67839992-67839993:-
mod Type Am Sequence GGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGA
Motif Score noScore
RNA Structure Motif ................(((.......)))..
MFE -1.20
Support Dataset Num 4 Support sub-Dataset Num 4
Support Dataset List
Support sub-Dataset List

GSE104947, GSE77024, snoRNABase, snOPY
Cell/Tissue List NA, HEK293
Seq Type List RiboMeth-seq
Transcript ID List ENST00000383898.1,rmsk_4369517
Transcript Detail

Transcript ID Gene ID Gene Name Gene Type Region
ENST00000383898.1ENSG00000206625.1RNU6-1snRNAexon-1
rmsk_4369517rmsk_4369517U6snRNAexon
Conserved Sites na
snoRNA Num 2 snoRNA Guide Site U6:53
snoRNA Guide Detail

snoRNA Guide Site snoRNA Guide Base snoRNA Name Box Source Database
U6:53ASNORD8C/DsnOPY
U6:53ASNORD9C/DsnOPY
U6:53ASNORD8C/DsnoRNABase
U6:53ASNORD9C/DsnoRNABase
writer Num 0 Writer Name List na
Writer Catalysis Detail na
PubMed ID

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.


© 2023, Qu Lab. School of Life Science, Sun Yat-sen University, China.
Guangdong ICP 2022122093 -1