RMBase v3.0: Decipher the Landscape, Mechanism and Function of RNA Modifications by Integrating Multi-dimensional High-throughput Sequencing Data.

Details of RNA Modification Site of hg38

mod ID

Nm_site_2241

mod Site

chr17:18245819-18245820:-

mod Type

Sequence

AAGGTGAGGAGCCTGAGAACTTCTTCTGGGTGGGCATTGGG

Motif Score

noScore

RNA Structure Motif

.....(((((((((....))))...))))).

MFE

-5.80

Support Dataset Num

Support sub-Dataset Num

Support Dataset List

GSE90164

Support sub-Dataset List

GSE90164

Cell/Tissue List

HeLa

Seq Type List

Nm-seq

Transcript ID List

ENST00000579294.5,ENST00000474265.5,ENST00000465046.1,ENST00000577398.6,ENST00000493401.1,ENST00000578101.5,ENST00000545457.6,ENST00000578558.5,ENST00000493600.6,ENST00000327031.9,ENST00000581858.5,ENST00000577485.1,ENST00000487369.5,ENST00000487693.5

Transcript Detail

Transcript ID	Gene ID	Gene Name	Gene Type	Region
ENST00000579294.5	ENSG00000177731.16	FLII	protein_coding	cds-27
ENST00000474265.5	ENSG00000177731.16	FLII	retained_intron	exon-3
ENST00000465046.1	ENSG00000177731.16	FLII	retained_intron	exon-1
ENST00000577398.6	ENSG00000177731.16	FLII	protein_coding	cds-2
ENST00000493401.1	ENSG00000177731.16	FLII	retained_intron	intron-2
ENST00000578101.5	ENSG00000177731.16	FLII	nonsense_mediated_decay	utr3-27
ENST00000545457.6	ENSG00000177731.16	FLII	protein_coding	cds-26
ENST00000578558.5	ENSG00000177731.16	FLII	protein_coding	intron-16
ENST00000493600.6	ENSG00000177731.16	FLII	retained_intron	exon-2
ENST00000327031.9	ENSG00000177731.16	FLII	protein_coding	cds-27
ENST00000581858.5	ENSG00000177731.16	FLII	nonsense_mediated_decay	intron-1
ENST00000577485.1	ENSG00000177731.16	FLII	protein_coding	cds-4
ENST00000487369.5	ENSG00000177731.16	FLII	retained_intron	exon-2
ENST00000487693.5	ENSG00000177731.16	FLII	retained_intron	exon-2

Conserved Sites

snoRNA Num

snoRNA Guide Site

snoRNA Guide Detail

writer Num

Writer Name List

FBL,NOP58

Writer Catalysis Detail

Writer Name	Writer ID	Writer Binding Site	Source
FBL	FBL:CH260572	chr17:18245786-18245843	SBDH121-145852
NOP58	NOP58:CH286705	chr17:18245812-18245849	SBDH122-198873

PubMed ID

28504680

Discription & Help

♥ There is a specific explanation when the mouse hover the logo in the upper right corner of each entry.

♥ The "modID" is unique ID among all modules and can be used to retrieve in all files of the RMBase v3.0 for more information.

♥ The "Motif score" is alignment score to evaluate the accuracy of identified motif regions of m6A. The higher of motif score means a more accurate motif and a more reliable modification site. The range is from 0 to 5.

♥ In "Transcript Detail", the "Gene Type" is gene biotypes including protein-coding genes (mRNAs), tRNAs, rRNAs, Mt-tRNAs, lincRNAs, pseudogenes etc.; While the "Region" is gene features including CDS, 3′-UTR, 5′-UTR, intron, exon and intergenic.

♥ Click the "Show Detail" button to show detailed list and click again to hide it.